The Piltdown Hoax Blog

1.       Piltdown was the gravel place in East Sussex England where Charles Dawson claimed that the man who work in the Piltdown gravel and found the pieces of bones to which Dawson believed that it was a fossil of the remain of early human. The remains were collected in 1912. Dawson collaborated with Arthur Smith Woodward, a keeper in British Museum who was also showed a vast of interest in Dawson discovery. Hence Dawson recovered more bones, skulls and fossils. However, the most controversial among his bones recovery was the skull that similar to human bone skull structure where they believed the human brain size fitted to their skull discovery. Other than the skull, the jaw also showed similarity to the chimps. Thus Woodward believed that the Piltdown man discovery was the missing of the evolutionary link. Until in 1915 when G.S Miller opened the first scientific investigation. Through a study and comparison in 1953 Oakley and other scientist proved that Piltdown man was a hoax. Everyone involve in the Piltdown discovery was believed had its own self-interest. Thus, many speculation came to the open. “The first solid evidence regarding the identity of the perpetrator emerged in 1996, two decades after a trunk marked with the initials M.A.C.H. had been discovered in storage at the British Museum. Upon analyzing bones found in the trunk, the British paleontologists Brian Gardiner and Andrew Currant found that they had been stained in the exact same way as the Piltdown fossils. The trunk apparently had belonged to Martin A.C. Hinton, who became keeper of zoology at the British Museum in 1936. Hinton, who in 1912 was working as a volunteer at the museum, may have treated and planted the Piltdown bones as a hoax in order to ensnare and embarrass Woodward, who had rebuffed Hinton’s request for a weekly wage. Hinton presumably used the bones in the steamer trunk for practice before treating the bones used in the actual hoax” (Britannica Encyclopedia).

 

The Scientific Method

 

2.       Lack of variables, credibility, reliability, validity of resources and the scientists; not following the exact Scientific method of research or experiment; not enough time, resources and funding for scientific investigation could be a possibility the causes of human faults in conducting research and experiments. In discoveries like this, it would take many factors of variables to consider on how the individuals treat or manipulate the variables. In every types of research there has always been the independent and dependent variables however it should always identify the moderator variable either it is controlled or confounding variables. Sometimes when manipulating the variables in a wrong way could also affect the experimentation process. Other, when one forgets to investigate the validity of resources could always be the downfall of many scientist and researchers. When Dawson kept bringing remains like fossils and bones structure, nobody contested the site of the location of the remains and who were the people who worked in the graveyard, what was their background and history and were the graveyard worker had enough credibility, or they just picked the bones anywhere. In conducting a research and experiments every person should always check the credibility and reliability of the resources.  Just like in many experimental researches, it would go to take several years to prove the validity of the experiment. Another thing to consider the scientific method.  Following scientific method is very important neither should skip any steps when conducting a research or experiment. Experiments and researches method are always chain linked to each other. If somebody misses, skip the method or contamination of variables would affect the validity and reliability of the research.

The Pildown Man Skull

 

3.       The positive aspects of scientific process were responsible in revealing that the skull was a fraud was the steps of analyzing and drawing conclusions when this part decided as to whether the hypothesis is valid or null before drawing the results. However, doubts began to rise in the discovery of the bones. First, the authenticity of the bones structures so as the skull. The shape of the skull was the most controversial of all because it only creates more problems and puzzle when giving the right specification.  If it was to believed a prehistoric human skull, none of its showed or distinguished of an early human skull hence it would showed more identification of modern human skull. Lack of upper portion of brow ridges of the jaw as of the early human skull structure. Lack of he portion that should attached between the jaw and the skull instead it directly attached the skull. The right placement of molars also created more problems in connecting it to the early human skull. Even King William Gregory stated that “skull and a broken ape jaw" had been "artificially fossilized" and "planted in the gravel bed to fool the scientists." Aside from scope that Dawson wanted to gain a royalty for his discovery many believed that it was a hoax.

4.       I do not think we could eliminate human factor in conducting experiments and researches. Just like any other researchers and experiments human still has a significant role in conducting it. One thing that so unique about human is the curiosity, reasoning and processing of the ideas using our human senses. Human reasoning could collect ideas that which come into consciousness that goes through a process. Errors are always seen in many researches and experiments hence human error mainly are the causes of errors however it’s all about trial and error until its proven valid. We might prevent the human errors or faults but we couldn’t totally perfect experimentation in one setting. I do not agree of eliminating human factor just I would say that human still playing a significant role in many experimental success.

5.       The lesson that I learned from this historical events was that human is always human and human commits error either consciously or unconsciously but also can perfected his skills. Human among the species on earth is the most genius and creative creature. Sometimes humans ruled by self-interest, pride and greed that lead to commit a hoax or crime. Human unique way in processing the ideas consciously created a vast experiments, researches, discoveries and invention. Thus error is always been a part of experimenting until proven to be valid. Regardless of what the real motive of the researchers or scientist the truth will always set us free. Validity has always been a factor of proving the hypothesis of experiement and many neglected it.

 

References:

BBC History

Britannica Encyclopedia

National Geographic

Photos: www.googleimages.com

Comparative Primate Blog Post

1.       Lemurs, Spider Monkey, Baboon, Gibbon, Chimpanzee

The expressions of the particular trait of the 5 categories of primates are:

1.       Behavior. Most of the primates have same behavior traits just like human. Their sexuality, infant care, aggression, grooming and communication.

2.       Social interactions are also very common. Most of the primates are territorial. They also have similarity in social systems such as mating and giving birth.

3.       Their physical traits are similar such as the flexible limbs, forward facing eyes, the arms, their chest, the physical feature of face and the fingers for gripping.

4.       The intelligence is shows similarity but the level of intelligence varies in many ways. Considering that baboons are more intelligent than chimpanzees when it comes to social interactions

5.       Among the 5 primates chimpanzee and gibbon are considered an ape which distinguished according to the physical feature such as broader chest and lack of tails and while lemur, spider monkey and baboon are considered monkeys because of their common physical feature. Though baboons are considered old world monkeys and the chimpanzees considered the species of the great apes.

2.       ABC: The Locomotor Patterns

Primate locomotion, being an aspect of behavior that arises out of anatomic structure, shows much of the conservativeness and opportunism that generally characterizes the order. Primates with remarkably few changes in their skeletons and musculature have adopted a bewildering variety of locomotor patterns. The “natural” habitat of primates—in the historical sense—is the canopy of the forest.

Vertical clinging and leaping, for instance, is primarily a function of the hind limbs, as is bipedalism, whereas brachiation is performed exclusively with the forelimbs. Quadrupedalism involves both forelimbs and hind limbs, of course, although not to an equal extent. Some quadrupeds are hind limb-dominated; in others, the forelimb and the hind limb are equally important. The hind limb-dominated primates, such as the langurs and colobus monkeys, employ a large element of leaping in their movements, a less-notable feature of the more generalized quadrupeds such as guenons. The quadrupedal category is inevitably somewhat of a grab bag, and the gaits included in it have not yet been studied critically. One subtype, here designated as slow climbing, differs profoundly from the other subtypes of the category, being somewhat ponderous and devoid of elements of leaping or jumping. The species in this category are lorises and pottos, all of which are arboreal and nocturnal.

Bipedalism- Some degree of bipedal ability, of course, is a basic possession of the order Primates. All primates sit upright. Many stand upright without supporting their body weight by their arms, and some, especially the apes, actually walk upright for short periods. The view that the possession of uprightness is a solely human attribute is untenable; humans are merely the one species of the order that has exploited the potential of this ancestry to its extreme. Chimpanzees, gorillas and gibbons, macaques, spider monkeys, capuchins, and others are all frequent bipedal walkers.

When the subject of primate arboreal locomotion is studied in evolutionary terms by using fossils, it becomes clear that locomotor categories are not discrete but constitute a continuum of change from a hind limb-dominated gait to a forelimb-dominated one. The best single indicator of gait, one that has the added advantage of being strictly quantitative, is the intermembral index. Briefly, the index is a ratio expressed as percentage of arm length to leg length; an index over 100 indicates relatively long arms. This provides a model by means of which the locomotion of an early primate can be inferred by determination of the intermembral index of the fossil skeleton. Animals do not necessarily fall discretely into categories. Species with indexes lying between those of clearly recognizable locomotor types represent transitional types, whose style of locomotion really does manifest features of both of the bracketing categories. Some lemurs have indexes that fall between 65 and 75, and their gait is a combination of vertical clinging and quadrupedalism. The South American spider monkeys (genus Ateles), whose index lies between 100 and 108, show a type of locomotion that contains the elements of both quadrupedalism and brachiation.

3.       A. Description of Environment:

Lemurs - There are at least 10 species of sportive lemurs (family Megaladapidae) that live throughout Madagascar in both rainforests and dry forests. The lemur lineage continued in tropical forests, however, and they were particularly successful in Madagascar, where they were relatively free from competition with more-advanced primates.

Spider Monkey- lives in forests from southern Mexico through Central and South America to Brazil.

Baboon- primarily terrrestrial monkeys found in dry regions of Africa and Arabia.

Five subspecies live in Africa, with one species extending into the Arabian peninsula. Baboons live in brush, grassland, or rocky country, foraging on the ground for roots, seeds, fruits, insects, and small animals, including other monkeys

Gibbon- The gibbons, including the siamang, are known as the small, or lesser, apes; they are the most highly adapted of the apes to arboreal life.

Chimpanzee- Chimpanzees inhabit tropical forests and savannas of equatorial Africa from The Gambia in the west to Lake Albert, Lake Victoria, and northwestern Tanzania in the east.

B. Specified character:

Lemurs- They are solitary and nocturnal, feeding on leaves and flowers, which are digested in their enormous cecum with the aid of bacteria. Bacterial fermentation enables energy to be extracted from the large quantity of otherwise indigestible cellulose in the lemur’s diet. Lemurs are docile, gregarious animals; some species live in groups of 10 or more. Most of their time is spent in the trees eating fruit, leaves, buds, insects, and small birds and birds’ eggs, but diet varies among different species. Some, for example, are mainly insectivorous, whereas others feed almost exclusively on foliage. All breed seasonally, and females may have only one fertile day during the entire year. Single offspring are usually born after two to five months’ gestation. The newborn lemur then clings to its mother’s underside until it is old enough to ride on her back.

Spider Monkey- Spider monkeys that are shot with arrows while being hunted for food sometimes remove the arrows with their hands and attempt to stem the bleeding. Wary of humans, they will break off tree branches and try to drop them on intruders, and they bark like terriers when approached. Spider monkeys also produce a variety of other sounds. When separated from other members of their group, they call to one another in a whinnying voice like a horse. They are also capable of prolonged screams. Spider monkeys are dextrous with their tail as well as their hands. They pick up objects with the tail, and they hang from branches by using the tail alone.

Baboon- Most species travel in groups of 40 to 80, which are socially based on a core of females and may include several transient males. Some subspecies, like the hamadryas baboon (Papio hamadryas hamadryas), form harem groups led by a dominant male and have a highly developed social order.

Gibbon- These acrobatic mammals, endemic to the dense forests of southern Asia, are perfectly adapted to life in the trees and rarely descend to the ground. They have strong, hook-shaped hands for grasping branches, comically outsize arms for reaching faraway limbs, and long, powerful legs for propelling and gasping. Their shoulder joints are even specially adapted to allow greater range of motion when swinging.

Chimpanzee- Chimpanzees awaken at dawn, and their day is spent both in the trees and on the ground. After a lengthy midday rest, late afternoon is usually the most intensive feeding period. In the trees, where most feeding takes place, chimps use their hands and feet to move about. They also leap and swing by their arms (brachiate) skillfully from branch to branch. Movement over any significant distance usually takes place on the ground. Though able to walk upright, chimpanzees more often move about on all fours, leaning forward on the knuckles of their hands (knuckle walking). At night they usually sleep in the trees in nests they build of branches and leaves. Chimpanzees are unable to swim, but they will wade in water. The chimpanzee diet is primarily vegetarian and consists of more than 300 different items, mostly fruits, berries, leaves, blossoms, and seeds but also bird eggs and chicks, many insects, and occasionally carrion. Chimpanzees also hunt both alone and in groups, stalking and killing various mammals such as monkeys, duikers, bushbucks, and wild pigs. They also appear to use certain plants medicinally to cure diseases and expel intestinal parasites.

C. Trait expression of the adapted environment

Lemurs- lives in rainforest of east and dry regions of the west most lemurs are very good “swingers” to avoid harsh climate and weather to survive. They are very distinct because of their ecological niches and the selection of the habitat. Their diet consist more of fruits thus for them survive they have a behavioral diversity and immense morphological.

Spider Monkey- lives in forests from southern Mexico through Central and South America to Brazil. In spite of its thumb less hands, this lanky potbellied primate can move swiftly through the trees, using its long tail as a fifth limb.

Baboon- Baboons live in brush, grassland, or rocky country, foraging on the ground for roots, seeds, fruits, insects, and small animals, including other monkeys. Depending on the species, they may gather in troops of 350 individuals or more for protection at sleep sites on rock outcroppings. Baboons are powerful fighters and show little fear of larger animals, including humans. They can successfully take on leopards, their worst enemies.

Gibbon- Gibbons thrive on the abundant fruit trees in their tropical range, and are especially fond of figs. They will occasionally supplement their diet with leaves and insects.

Chimpanzee- Chimpanzees inhibits forest.  The common chimpanzee is a frugivorous species, but will also consume seeds, nuts, flowers, leaves, pith, honey, insects, eggs, and vertebrates, including monkeys. During the dry season when fruit becomes scare seeds as well as bark, flowers, resin, pith, and galls are important food resources. Through their geographical location many chimpanzees are hunt food over again through the use of their cognitive maps.

Chimpanzees exhibit complex social strategies such as cooperation in combat and the cultivation of coalitions and alliances via ranging together, reciprocal grooming, and the sharing of meat (sometimes in exchange for mating opportunities).

D. Image of the primate:

 

4.       The level of environmental influence is extremely important to the expression and behavioral traits because adaptation is important for survival. Animals just like humans they have the natural traits to adapt to the environment in order to survive. The weather conditions, the temperature, the food are some of the factors that needed to be considered for adaptations. The most intriguing behavioral trait is of the spider monkeys. That when shot with arrows while being hunted for food sometimes remove the arrows with their hands and attempt to stem the bleeding. This is one of the survival techniques and adaptations. Though they are thumb less yet they adapted ways to swing using their long tail as a fifth limb.  Baboons which commonly found in Africa also have special feature traits for survival. Africa is known for hot and warm weather so thus Baboon has a thick fur to survive and adapt the environmental factors. Like the primates, humans are capable of adapting toward his environment. Like many of tropical Asian country people who migrated to colder countries will similarly adapted to the environment. Skin color has also proven to be one of the factors for survival and adapting environment. Many Asians are brown skinned specially those who live in tropical regions.  Thus, In Darwin’s theory Survival of the Fittest was extremely given emphasis in the evolution or the natural selection. Those who are not fit to survive will never evolve.

 

Reference:

Britannica Encyclopedia

NatGeo.com

Photos: Googleimage.com; natgeo.com

Homologous vs. Analogous Traits

A.      Homologous trait: The flipper of Whale and Alligator forelimb

 

 

1.       Alligators, like other crocodilians, are large animals with powerful tails that are used both in defense and in swimming. Their eyes, ears, and nostrils are placed on top of their long head and project slightly above the water when the reptiles float at the surface, as they often do. Alligators can be differentiated from crocodiles by the form of their jaw and teeth. Alligators possess a broad, U-shaped snout and have an “overbite”—that is, all the teeth of the lower jaw fit within (lingual to) the teeth of the upper jaw. The large fourth tooth on each side of the alligator’s lower jaw fits into a socket in the upper jaw.

 

 

Whales’ larger species of aquatic mammals belonging to the order Cetacean. The term whale can be used in reference to any cetacean, including porpoises and dolphins, but in general it is applied to those more than 3 meters (10 feet) long. An exception is the 2.7-metre dwarf sperm whale (Kogia simus), so called for its otherwise striking resemblance to its larger namesake. Whales are the heaviest known animals, living or fossil, reaching a maximum size in the blue whale (Balaenoptera musculus) of perhaps more than 30 meters and 200 metric tons (220 short [U.S.] tons).

 

Whales flipper (bone structure)

 

Alligator forelimb (bone structure)

 

2.       The bones in the forelimbs of alligator and whales are the same so as the structure of bones attached to each other are similar. Both are similar in radius bones, ulna, carpals, metacarpals, phalanges. Tetrapod is a group of vertebrate animals with four limbs with five digits on each limb. However, the size and shape of the limb bones may also be different from one animal to another.

3.       Since both species are vertebrates I would say that the common ancestors of the two species are the tetrapods. It is said to be that in evolution the tetrapods, fishes and vertebrates animals diverged into one. Thus during the Devonian Age or age of fishes marked the numerous species of fish. Since then evolution of fishes started. Bony fishes started to resemble cartilaginous fins. Biologists believe that over million years the only vertebrate exist are the water creatures. As it time evolve so as the water dwelling creatures and started to developed  legs and hips which eventually develop lungs and would able to survive the land surface and the reason to believe how alligators shares same bone structure of the forelimb as to the whales.

4.       Photos:

Alligator

 

                                                                          Whale

B. Analogous trait: Tasmanian Devils and Hyenas

1.  Tasmanian devils are related to quolls; both are classified in the family Dasyuridae. The teeth and jaws of Tasmanian devils are in many respects developed like those of a hyena. The pouch, when relaxed, opens backward, but, when the muscles are contracted to close it, the opening is central. During the breeding season, 20 or more eggs may be released, but most of these fail to develop. In most cases just four young are produced after a gestation period of about three weeks; these remain in the pouch for about five months. Overall, female offspring outnumber males about two to one. is a carnivorous marsupial of the family Dasyuridae. The size of a small dog, it became the largest carnivorous marsupial. Hyena (family Hyaenidae), also spelled hyaena , any of three species of coarse-furred, doglike carnivores found in Asia and Africa and noted for their scavenging habits. Hyenas have long forelegs and a powerful neck and shoulders for dismembering and carrying prey. Hyenas are tireless trotters with excellent sight, hearing, and smell for locating carrion, and they are proficient hunters as well. All hyenas are more or less nocturnal.

2. Tasmanian Devil and Hyena shares common resemblances. Both are mammals, carnivores and dog-like resemblance. Both came from different ancestors and environment however not homologous but they share a lot of analogous traits.

 Tasmanian Devils are stocky carnivorous marsupial with heavy forequarters, weak hindquarters, and a large squarish head. Hyena skulls superficially resemble those canids however it is heavier and larger than ordinary canids with shorter facial portions. Both have similarity of skull structure.

The Tasmanian devil is named for the Australian island-state of Tasmania, its only native habitat. Vaguely bearlike in appearance and weighing up to 12 kg (26 pounds), it is 50 to 80 cm (20 to 31 inches) long and has a bushy tail about half that length. The smaller brown hyena weighs about 40 kg; the coat is shaggy and dark with an erectile white mane over the neck and shoulders and horizontal white bands on the legs. Hyenas usually found in East and Southern Africa. Hyenas have relatively short torsos, and are fairly massive and wolf-like in build, but have lower hind quarters, high withers and their backs slope noticeably downward toward their croups. The forelegs are high, while the hind legs are very short and their necks are thick and short. They are dog-like animals with a sloping body, as their front legs are longer than their hind legs. They have a short, sandy coat, covered with dark brown spots or stripes on the body and legs

Tasmanian Devils coat is mainly black, and there is a whitish breast mark; sometimes the rump and sides are white-marked as well. Hyenas color is pale gray with black throat fur and stripes on the body and legs. The hair is long, with a crest running from behind the ears to the tail; the crest is erected to make the animal look larger.

Tasmanian Devils Gaping jaws and strong teeth, along with its husky snarl and often bad temper, result in its devilish expression. It is mainly a scavenger, feeding on carrion such as road kill and dead sheep. The larvae of certain beetles are its major source of live food, but it has been known to attack poultry. While Hyenas are known for being a talented scavengers. Their jaws have bone-crunching strength and their digestive systems are adapted to digest bone and skin, animal parts that other predators cannot handle. Both are scavengers, bad tempered and have strong jaws and teeth.Though Tasmanian devils are known to be nocturnal however Hyenas tend to be nocturnal.

3. As hyenas shares a lot of common resemblances in many aspects to canines but it was believed that it originated in Miocene period which is also believed from  viverrid-like ancestors that evolve to a dog-like structure. While Tasmanian Devils are from Dasyuridae family. Biologists speculate that their extinction on the mainland is attributable to the introduction of Asian dogs, or dingoes.

4. Photos:

Hyena (family: Hyaenidae)

Tasmanian Devil (Family: Dasyuridae)

References:

Britannica Encyclopedia.

National Geographic. www.natgeo.com

Photos:  Google images. www.googleimages.com; National Geographic. www.natgeo.com

 

 

Sally's DNA strand

ACCTTACACCCGGTAAATGTCTGGGAACGGCAGTGCAAGCTTGATCTCCG